STRINGSTRING
EF_0363 EF_0363 EF_2185 EF_2185 EF_2186 EF_2186 EF_2187 EF_2187 EF_2188 EF_2188
Nodes:
Network nodes represent proteins
splice isoforms or post-translational modifications are collapsed, i.e. each node represents all the proteins produced by a single, protein-coding gene locus.
Node Color
colored nodes:
query proteins and first shell of interactors
white nodes:
second shell of interactors
Node Content
empty nodes:
proteins of unknown 3D structure
filled nodes:
a 3D structure is known or predicted
Edges:
Edges represent protein-protein associations
associations are meant to be specific and meaningful, i.e. proteins jointly contribute to a shared function; this does not necessarily mean they are physically binding to each other.
Known Interactions
from curated databases
experimentally determined
Predicted Interactions
gene neighborhood
gene fusions
gene co-occurrence
Others
textmining
co-expression
protein homology
Your Input:
EF_0363ISEf1, transposase; Required for the transposition of the insertion element. (392 aa)
EF_2185ISEf1, transposase; IRleft=GAGAGTGTAAAATATTTTGT; IRright=GGGAGCGTCAATAATTTTGT; similar to GB:X15145, SP:P26998, PID:1340164, GB:X15145, SP:P26998, and PID:1340164; identified by sequence similarity; putative. (392 aa)
EF_2186Conserved domain protein; Similar to GP:5458888; identified by sequence similarity; putative. (83 aa)
EF_2187IS256, transposase; Similar to GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1335280, PID:187399, PID:188984, PID:35190, PID:35193, and PID:747844; identified by sequence similarity; putative. (390 aa)
EF_2188Racemase domain protein; Similar to GP:4545123, and SP:Q9KHL7; identified by sequence similarity; putative. (234 aa)
Your Current Organism:
Enterococcus faecalis V583
NCBI taxonomy Id: 226185
Other names: E. faecalis V583, Enterococcus faecalis str. V583, Enterococcus faecalis strain V583
Server load: low (14%) [HD]
STRING is a Core Data Resource as designated by Global Biodata Coalition and ELIXIR.