STRINGSTRING
rodA rodA mrdA mrdA BPSL0184 BPSL0184 BPSL0185 BPSL0185 mreB mreB glmU glmU BPSL0408 BPSL0408 BPSL0409 BPSL0409 BPSL0805 BPSL0805 murB murB glmM glmM BPSL1512 BPSL1512 BPSL2104 BPSL2104 dadX dadX ftsZ ftsZ ftsA ftsA ftsQ ftsQ ddlB ddlB murC murC murG murG ftsW ftsW murD murD mraY mraY murF murF murE murE ftsI ftsI ftsL ftsL mraW mraW mraZ mraZ murA murA mrcA mrcA BPSS0238 BPSS0238 mreB-2 mreB-2 dadX-2 dadX-2 BPSS0984 BPSS0984 ald ald ftsI-3 ftsI-3 BPSS1239 BPSS1239 ftsI-2 ftsI-2 BPSS2304 BPSS2304
Nodes:
Network nodes represent proteins
splice isoforms or post-translational modifications are collapsed, i.e. each node represents all the proteins produced by a single, protein-coding gene locus.
Node Color
colored nodes:
query proteins and first shell of interactors
white nodes:
second shell of interactors
Node Content
empty nodes:
proteins of unknown 3D structure
filled nodes:
a 3D structure is known or predicted
Edges:
Edges represent protein-protein associations
associations are meant to be specific and meaningful, i.e. proteins jointly contribute to a shared function; this does not necessarily mean they are physically binding to each other.
Known Interactions
from curated databases
experimentally determined
Predicted Interactions
gene neighborhood
gene fusions
gene co-occurrence
Others
textmining
co-expression
protein homology
Your Input:
rodARod shape-determining protein; Peptidoglycan polymerase that is essential for cell wall elongation; Belongs to the SEDS family. MrdB/RodA subfamily. (382 aa)
mrdAPenicillin-binding protein; Catalyzes cross-linking of the peptidoglycan cell wall. Belongs to the transpeptidase family. MrdA subfamily. (818 aa)
BPSL0184Similar to Escherichia coli rod shape-determining protein MreD SWALL:MRED_ECOLI (SWALL:P16927) (162 aa) fasta scores: E(): 1.4e-06, 29.41% id in 153 aa, and to Ralstonia solanacearum probable rod shape-determining mred transmembrane protein rsc0061 or rs01884 SWALL:Q8Y3B9 (EMBL:AL646057) (170 aa) fasta scores: E(): 2.7e-43, 65.29% id in 170 aa. (170 aa)
BPSL0185Similar to Escherichia coli rod shape-determining protein MreC SWALL:MREC_ECOLI (SWALL:P16926) (367 aa) fasta scores: E(): 4e-23, 32.77% id in 357 aa, and to Ralstonia solanacearum probable rod shape-determining MreC transmembrane protein rsc0060 or rs01883 SWALL:Q8Y3C0 (EMBL:AL646057) (346 aa) fasta scores: E(): 2.1e-44, 46.62% id in 356 aa. (357 aa)
mreBPutative rod shape-determining protein; Similar to Escherichia coli, Salmonella typhimurium, and Salmonella typhi rod shape-determining protein MreB or EnvB or RodY SWALL:MREB_ECOLI (SWALL:P13519) (347 aa) fasta scores: E(): 1.7e-87, 71.14% id in 350 aa, and to Ralstonia solanacearum probable rod shape-determining protein rsc0059 or rs01882 SWALL:Q8Y3C1 (EMBL:AL646057) (347 aa) fasta scores: E(): 1.9e-114, 93.66% id in 347 aa. Similar to BPSS0633, 54.955% identity (54.955% ungapped) in 333 aa overlap. (347 aa)
glmUBifunctional glmU protein [includes: UDP-N-acetylglucosamine pyrophosphorylase; Catalyzes the last two sequential reactions in the de novo biosynthetic pathway for UDP-N-acetylglucosamine (UDP-GlcNAc). The C- terminal domain catalyzes the transfer of acetyl group from acetyl coenzyme A to glucosamine-1-phosphate (GlcN-1-P) to produce N- acetylglucosamine-1-phosphate (GlcNAc-1-P), which is converted into UDP-GlcNAc by the transfer of uridine 5-monophosphate (from uridine 5- triphosphate), a reaction catalyzed by the N-terminal domain. In the C-terminal section; belongs to the transferas [...] (453 aa)
BPSL0408Similar to Escherichia coli penicillin-binding protein 6 precursor DacC SWALL:DACC_ECOLI (SWALL:P08506) (400 aa) fasta scores: E(): 5.8e-48, 42.21% id in 379 aa, and to Ralstonia solanacearum probable penicillin-binding rsc0327 or rs03294 SWALL:Q8Y2K8 (EMBL:AL646058) (397 aa) fasta scores: E(): 1.8e-79, 58.8% id in 403 aa; Belongs to the peptidase S11 family. (403 aa)
BPSL0409Putative D-amino acid aminotransferase; Similar to Bacillus licheniformis D-alanine aminotransferase Dat SWALL:DAAA_BACLI (SWALL:P54692) (283 aa) fasta scores: E(): 8.7e-28, 40.42% id in 282 aa, and to Listeria innocua D-alanine aminotransferase lin1660 SWALL:DAAA_LISIN (SWALL:Q92B90) (289 aa) fasta scores: E(): 1.8e-27, 36.74% id in 283 aa. (315 aa)
BPSL0805Family S13 unassigned peptidase; Weakly similar to Escherichia coli penicillin-binding protein 4 precursor DacB or b3182 SWALL:PBP4_ECOLI (SWALL:P24228) (477 aa) fasta scores: E(): 2.3e-23, 26.06% id in 422 aa. Similar to Ralstonia solanacearum probable D-alanyl-D-alanine carboxypeptidase signal peptide protein rsc0584 or rs04879 SWALL:Q8Y1V5 (EMBL:AL646060) (514 aa) fasta scores: E(): 1.3e-86, 54.25% id in 494 aa; Downstream repeat region (cggcgagggaaacggcgagggaaacggcgagggaaa)3. (483 aa)
murBPutative UDP-N-acetylenolpyruvoylglucosamine reductase; Cell wall formation. (349 aa)
glmMPutative phosphoglucomutase; Catalyzes the conversion of glucosamine-6-phosphate to glucosamine-1-phosphate; Belongs to the phosphohexose mutase family. (452 aa)
BPSL1512Conserved hypothetical protein; Similar to Ralstonia solanacearum probable transmembrane protein rsc1214 or rs02709 SWALL:Q8Y030 (EMBL:AL646063) (367 aa) fasta scores: E(): 5.1e-17, 34.87% id in 367 aa, and to Escherichia coli hypothetical protein YfgA or b2516 SWALL:YFGA_ECOLI (SWALL:P27434) (337 aa) fasta scores: E(): 3.3e-06, 27.85% id in 341 aa. (362 aa)
BPSL2104Putative penicillin-binding protein; Similar to Ralstonia solanacearum probable penicillin-binding 1 rsc2976 or rs01357 SWALL:Q8XV55 (EMBL:AL646073) (801 aa) fasta scores: E(): 2.2e-183, 61.61% id in 805 aa, and to Neisseria lactamica penicillin-binding protein 1A MrcA or PonA SWALL:PBPA_NEILA (SWALL:O87579) (798 aa) fasta scores: E(): 4.3e-129, 47.4% id in 791 aa. Note: This CDS is longer in its N-terminal region than most of its database matches. (852 aa)
dadXAlanine racemase, catabolic; Catalyzes the interconversion of L-alanine and D-alanine. May also act on other amino acids; Belongs to the alanine racemase family. (356 aa)
ftsZCell division protein FtsZ; Essential cell division protein that forms a contractile ring structure (Z ring) at the future cell division site. The regulation of the ring assembly controls the timing and the location of cell division. One of the functions of the FtsZ ring is to recruit other cell division proteins to the septum to produce a new cell wall between the dividing cells. Binds GTP and shows GTPase activity. (398 aa)
ftsACell division protein FtsA; Cell division protein that is involved in the assembly of the Z ring. May serve as a membrane anchor for the Z ring. Belongs to the FtsA/MreB family. (410 aa)
ftsQCell division protein FtsQ; Essential cell division protein. May link together the upstream cell division proteins, which are predominantly cytoplasmic, with the downstream cell division proteins, which are predominantly periplasmic. May control correct divisome assembly. (250 aa)
ddlBD-alanine--d-alanine ligase B; Cell wall formation. (312 aa)
murCUDP-N-acetylmuramate--alanine ligase; Cell wall formation; Belongs to the MurCDEF family. (465 aa)
murGUndecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase; Cell wall formation. Catalyzes the transfer of a GlcNAc subunit on undecaprenyl-pyrophosphoryl-MurNAc-pentapeptide (lipid intermediate I) to form undecaprenyl-pyrophosphoryl-MurNAc- (pentapeptide)GlcNAc (lipid intermediate II); Belongs to the glycosyltransferase 28 family. MurG subfamily. (367 aa)
ftsWCell division protein FtsW; Peptidoglycan polymerase that is essential for cell division. Belongs to the SEDS family. FtsW subfamily. (430 aa)
murDUDP-N-acetylmuramoylalanine--D-glutamate ligase; Cell wall formation. Catalyzes the addition of glutamate to the nucleotide precursor UDP-N-acetylmuramoyl-L-alanine (UMA). Belongs to the MurCDEF family. (496 aa)
mraYphospho-N-acetylmuramoyl-pentapeptide- transferase; First step of the lipid cycle reactions in the biosynthesis of the cell wall peptidoglycan; Belongs to the glycosyltransferase 4 family. MraY subfamily. (389 aa)
murFUDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanyl ligase; Involved in cell wall formation. Catalyzes the final step in the synthesis of UDP-N-acetylmuramoyl-pentapeptide, the precursor of murein; Belongs to the MurCDEF family. MurF subfamily. (468 aa)
murEUDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase; Catalyzes the addition of meso-diaminopimelic acid to the nucleotide precursor UDP-N-acetylmuramoyl-L-alanyl-D-glutamate (UMAG) in the biosynthesis of bacterial cell-wall peptidoglycan. Belongs to the MurCDEF family. MurE subfamily. (514 aa)
ftsIPeptidoglycan synthetase FtsI; Catalyzes cross-linking of the peptidoglycan cell wall at the division septum; Belongs to the transpeptidase family. FtsI subfamily. (614 aa)
ftsLCell division protein FtsL; Essential cell division protein. May link together the upstream cell division proteins, which are predominantly cytoplasmic, with the downstream cell division proteins, which are predominantly periplasmic. (109 aa)
mraWS-adenosyl-methyltransferase MraW; Specifically methylates the N4 position of cytidine in position 1402 (C1402) of 16S rRNA. (313 aa)
mraZConserved hypothetical protein; Similar to Escherichia coli protein MraZ or b0081 SWALL:MRAZ_ECOLI (SWALL:P22186) (152 aa) fasta scores: E(): 7.8e-19, 42.58% id in 155 aa; Belongs to the MraZ family. (142 aa)
murAUDP-N-acetylglucosamine 1-carboxyvinyltransferase; Cell wall formation. Adds enolpyruvyl to UDP-N- acetylglucosamine; Belongs to the EPSP synthase family. MurA subfamily. (449 aa)
mrcASimilar to Escherichia coli penicillin-binding protein 1A MrcA or PonA or b3396 SWALL:PBPA_ECOLI (SWALL:P02918) (850 aa) fasta scores: E(): 1.9e-88, 38.63% id in 818 aa. (773 aa)
BPSS0238Similar to Bacillus subtilis penicillin-binding protein 1A/1B PonA SWALL:PBPA_BACSU (SWALL:P39793) (914 aa) fasta scores: E(): 8.7e-44, 30.94% id in 685 aa, and to Escherichia coli penicillin-binding protein 1B MrcB or PonB or PbpF or b0149 SWALL:PBPB_ECOLI (SWALL:P02919) (844 aa) fasta scores: E(): 9.3e-43, 31.98% id in 591 aa. (720 aa)
mreB-2Rod shape-determining protein; Similar to Escherichia coli, Salmonella typhimurium, Salmonella typhi, and Shigella flexneri rod shape-determining protein MreB SWALL:MREB_ECOLI (SWALL:P13519) (347 aa) fasta scores: E(): 3.8e-57, 51.43% id in 348 aa, and to Ralstonia solanacearum probable rod shape-determining protein rsc0059 or rs01882 SWALL:Q8Y3C1 (EMBL:AL646057) (347 aa) fasta scores: E(): 3.5e-63, 54.95% id in 333 aa. Similar to BPSL0186, 54.955% identity (54.955% ungapped) in 333 aa overlap. (354 aa)
dadX-2Alanine racemase, catabolic; Catalyzes the interconversion of L-alanine and D-alanine. May also act on other amino acids; Belongs to the alanine racemase family. (374 aa)
BPSS0984Similar to Escherichia coli, and Shigella flexneri UDP-N-acetylglucosamine 1-carboxyvinyltransferase MurA or MurZ SWALL:MURA_ECOLI (SWALL:P28909) (419 aa) fasta scores: E(): 3.9e-30, 31.79% id in 434 aa, and to Borrelia burgdorferi UDP-N-acetylglucosamine 1-carboxyvinyltransferase bb0472 SWALL:MURA_BORBU (SWALL:O51428) (427 aa) fasta scores: E(): 9.1e-49, 33.95% id in 430 aa. (433 aa)
aldSimilar to Vibrio proteolyticus alanine dehydrogenase ald SWALL:O85596 (EMBL:AF070716) (374 aa) fasta scores: E(): 5.5e-77, 63.76% id in 367 aa, and to Vibrio cholerae alanine dehydrogenase vc1905 SWALL:Q9KQU3 (EMBL:AE004266) (374 aa) fasta scores: E(): 3.2e-77, 64.01% id in 364 aa; Belongs to the AlaDH/PNT family. (371 aa)
ftsI-3Putative penicillin-binding protein; Catalyzes cross-linking of the peptidoglycan cell wall at the division septum. (594 aa)
BPSS1239Family S11 unassigned peptidase; Similar to Pseudomonas putida D-alanyl-D-alanine carboxypeptidase DacA or pp4803 SWALL:AAN70372 (EMBL:AE016792) (386 aa) fasta scores: E(): 3.1e-33, 42.75% id in 276 aa, and to Ralstonia solanacearum probable penicillin-binding Dac or rsc0327 or rs03294 SWALL:Q8Y2K8 (EMBL:AL646058) (397 aa) fasta scores: E(): 4.4e-45, 44.87% id in 312 aa, and to Xanthomonas axonopodis penicillin-binding protein 6 DacC or xac0664 SWALL:Q8PPM2 (EMBL:AE011695) (401 aa) fasta scores: E(): 1.2e-33, 38.8% id in 268 aa; Belongs to the peptidase S11 family. (333 aa)
ftsI-2Similar to Neisseria gonorrhoeae penicillin-binding protein 2 PenA SWALL:PBP2_NEIGO (SWALL:P08149) (581 aa) fasta scores: E(): 1.9e-65, 37.97% id in 574 aa, and to Ralstonia solanacearum probable penicillin-binding 3 precursor pbp-3 transmembrane protein FtsI or rsc2850 or rs00255 SWALL:Q8XVI1 (EMBL:AL646072) (595 aa) fasta scores: E(): 1e-84, 46.4% id in 556 aa, and to Xanthomonas axonopodis penicillin-binding protein 3 FtsI or xac0774 SWALL:AAM35662 (EMBL:AE011708) (622 aa) fasta scores: E(): 2.7e-68, 40.76% id in 547 aa. (570 aa)
BPSS2304Penicillin-binding protein; Internal region is similar to an internal region of Escherichia coli penicillin-binding protein 1A MrcA or PonA SWALL:PBPA_ECOLI (SWALL:P02918) (850 aa) fasta scores: E(): 1.4e-21, 30.8% id in 737 aa. C-terminal region is similar to Chlorobium tepidum penicillin-binding protein 1 CT0176 SWALL:AAM71424 (EMBL:AE012797) (763 aa) fasta scores: E(): 1.5e-58, 36.31% id in 771 aa. (839 aa)
Your Current Organism:
Burkholderia pseudomallei
NCBI taxonomy Id: 272560
Other names: B. pseudomallei K96243, Burkholderia pseudomallei K96243, Burkholderia pseudomallei str. K96243, Burkholderia pseudomallei strain K96243
Server load: low (24%) [HD]
STRING is a Core Data Resource as designated by Global Biodata Coalition and ELIXIR.